View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_35 (Length: 241)
Name: NF10838_low_35
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 4411023 - 4410920
Alignment:
| Q |
1 |
tctcaagtttagtttctctaaataggatgaaccaaatctgaagcaatctcaggagcagatatatgaactaatgggagagcaccttcacaatactataaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4411023 |
tctcaagtttagtttctctaaataggatgaaccaaatctgaagcaatctcaggagcagatatatgaactaataggagagcaccttcacaatactataaat |
4410924 |
T |
 |
| Q |
101 |
aaac |
104 |
Q |
| |
|
|||| |
|
|
| T |
4410923 |
aaac |
4410920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 171 - 223
Target Start/End: Complemental strand, 4410919 - 4410867
Alignment:
| Q |
171 |
caagagactgtcttccttctagaatgccttcactaagttgtaaccacaatgaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410919 |
caagagactgtcttccttctagaatgccttcactaagttgtaaccacaatgaa |
4410867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University