View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_39 (Length: 240)
Name: NF10838_low_39
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 121 - 223
Target Start/End: Original strand, 27880948 - 27881050
Alignment:
| Q |
121 |
aatccactcctttgctaggtcccaccactttcgtcatgttcttggtgcattctctcaattgggttctcttggtcttgttcctgatagttatcttcttcct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880948 |
aatccactcctttgctaggtcccaccactttcgtcatgttcttggtgcattctctcaattgggttctcttggtcttgttcctgatagttatcttcttcct |
27881047 |
T |
 |
| Q |
221 |
agt |
223 |
Q |
| |
|
||| |
|
|
| T |
27881048 |
agt |
27881050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University