View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10838_low_42 (Length: 232)
Name: NF10838_low_42
Description: NF10838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10838_low_42 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 34943618 - 34943387
Alignment:
| Q |
1 |
actgataagaagatacatccagcttggtaaatgacttcagtttctgcttctttttctgatgctcattaagctgatgtttgcatccagctagtttctgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34943618 |
actgataagaagatacatccagcttggtaaatgacttcagtttctgcttctttttctgatgctcattaagctgatgtttgcatccagctagtttctgcac |
34943519 |
T |
|
| Q |
101 |
tttgttgttttggcttcaagggtggcaattttggcaacacccaacttggggaacctctaagccatagcgcttcacctgtgtctttgtgcttgaaatcggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34943518 |
tttgttgttttggcttcaagggtggcaattttggcaacacccaacttggggaacctctaagccatagcgcttcacctgtgtctttgtgcttgaaatcggg |
34943419 |
T |
|
| Q |
201 |
tccttttggattcttctgatatgatcaaaacg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34943418 |
tccttttggattcttctgatatgatcaaaacg |
34943387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 139 - 229
Target Start/End: Complemental strand, 34942815 - 34942725
Alignment:
| Q |
139 |
acccaacttggggaacctctaagccatagcgcttcacctgtgtctttgtgcttgaaatcgggtccttttggattcttctgatatgatcaaa |
229 |
Q |
| |
|
||||||||||| ||| |||||||||| ||| || |||| || ||||||||||||||||| || || ||| || |||||||||||||||| |
|
|
| T |
34942815 |
acccaacttggtgaatctctaagccacagccctacaccagtatctttgtgcttgaaatctggagctcttgcatatttctgatatgatcaaa |
34942725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University