View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_high_11 (Length: 241)
Name: NF10839_high_11
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 62 - 224
Target Start/End: Complemental strand, 5537371 - 5537211
Alignment:
| Q |
62 |
tgatatataaactccacttataattgggtctattcttacatcttaaatatgggtctatctctttcttttagctatattaaggtgggtttattnnnnnnnt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5537371 |
tgatatataaactccacttataattgggtctattcttacatcttaaatatgggtctatctctttcttttagctatattaaggtgggtttattaaaaaaat |
5537272 |
T |
 |
| Q |
162 |
ctatattaaagtgggatttgacatgtgtgattacttctgctctgatgaattcatgataatgtt |
224 |
Q |
| |
|
| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5537271 |
c--tattaaggtgggatttgacatgtgtgattacatctgctctgatgaattcatgataatgtt |
5537211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 5537507 - 5537444
Alignment:
| Q |
1 |
atatatttagttaaattaattgagtttacgaaaattctttgatgtcaatcgtcaatttggatga |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5537507 |
atatatttagttaaattaattgagtttacaaaaattctttgatgtcaatcgtcaatttggatga |
5537444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University