View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_high_9 (Length: 246)
Name: NF10839_high_9
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 32376284 - 32376051
Alignment:
| Q |
1 |
tttcattttctctgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagctgatgaagatgttcagatttttgctttgg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376284 |
tttcattttctgtgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagctgatgaagatgttcagatttttgctttgg |
32376185 |
T |
 |
| Q |
101 |
ttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtccaagatgatttgtttcatcatttgattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376184 |
ttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtccaagatgatttgtttcatcatttgattta |
32376085 |
T |
 |
| Q |
201 |
ctatggaacttggtctagttcatttgtcttgtct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32376084 |
ctatggaacttggtctagttcatttgtcttgtct |
32376051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University