View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_low_1 (Length: 456)
Name: NF10839_low_1
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_low_1 |
 |  |
|
| [»] scaffold0018 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 166; Significance: 1e-88; HSPs: 3)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 229 - 453
Target Start/End: Original strand, 170653 - 170894
Alignment:
| Q |
229 |
tcaaatcatgggaataacaaccgtatgagattgggtccccaactatgggtttataagtgatac-----------------gtaaaccttcttctatgttt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
170653 |
tcaaatcatgggaataacaaccgtatgagattgggtccccaactatgggttaataagtgatacacactcttattttataggtaaaccttcttctatgttt |
170752 |
T |
 |
| Q |
312 |
taacatatactcgatgtgggacttgttattaagcctgaagagaaaaaccaaagtctcatgtgaaggttacaagagaagaagaagcttcaatatctaaagg |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170753 |
taacatatactcgatgtgggacttgttattatgcccgaagagaaaaaccaaagtctcatgtgaaggttacaagagaagaagaagcttcaatatctaaagg |
170852 |
T |
 |
| Q |
412 |
aattccaaatccaacaagctgcagaaaggttcatctcactcg |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
170853 |
aattccaaatccaacaagctgcagaaaggtttatctctctcg |
170894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 153 - 227
Target Start/End: Original strand, 170479 - 170553
Alignment:
| Q |
153 |
agaacccctagagtaatttcttctcaacaatgaaggtttgaaattttaaattggtttaattatatacagtcatta |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
170479 |
agaacccctagagtaatttcttctcaacaatgaaggtttgaaattttaaattggtttaattatatacagtcatta |
170553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 170345 - 170411
Alignment:
| Q |
18 |
actaacatgagaagaaaaagaggcctattgaaaacatatataagagaccaaaacagaacctttattg |
84 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
170345 |
actaacatgagaagaaaaggaggcatattgaaaacatatataagagaccaaaacgaaacttttattg |
170411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 413
Target Start/End: Complemental strand, 31045982 - 31045885
Alignment:
| Q |
307 |
tgttttaacatatactcgatgtgggacttgttattaagcctgaagagaaaaaccaaagtctcatgtgaaggttacaagagaagaagaagcttcaatatct |
406 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||| |||||||||||| | |
|
|
| T |
31045982 |
tgttttaacacatactcgatgtgggacttgttata-----tgaagagaaaaacgaaagtttcatgtgaaggttacaagagaa----aagcttcaatatat |
31045892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 193 - 227
Target Start/End: Complemental strand, 31057017 - 31056983
Alignment:
| Q |
193 |
aaattttaaattggtttaattatatacagtcatta |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31057017 |
aaattttaagttggtttaattatatacagtcatta |
31056983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University