View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_low_15 (Length: 245)
Name: NF10839_low_15
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 244
Target Start/End: Complemental strand, 47063432 - 47063194
Alignment:
| Q |
3 |
aagcaaaggtctgattttatgtacgattgatcagaatgaaactgaaatgacaaaaataccaatacattagcatccaaatgtatattgcttgagaagattt |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47063432 |
aagcataggtctgattttatgtacgattgatcagaatgaaactgaaatgacaaaaataccaatacattagcatccaaatgtatattgtttgagaagattt |
47063333 |
T |
 |
| Q |
103 |
tctaataaaaaagcacaacaacactgtaacaattgatgaaaactaggggagacaagagtgggaggacaagagcgtgcgtttgtgattgtgatcgtccatc |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47063332 |
tctaataaaaaagcacaaca---ctgtaacaattgatgaaaactaggggagacaagagtgggaggacaagagtgtgcgtttgtgattgtgatcgtccatc |
47063236 |
T |
 |
| Q |
203 |
ttattattattggatgcaaggaattgtatagagagatactga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47063235 |
ttattattattggatgcaaggaattgtatagagagatactga |
47063194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University