View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_low_19 (Length: 222)
Name: NF10839_low_19
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 30054961 - 30054760
Alignment:
| Q |
1 |
attcacgttcgtattggagtatttaacaaagtatacttccccaactctcttaatttgcctgctttaaccaccttggctgtaaggttcttccactttcgcg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30054961 |
attcacgttcgtattgtagtatttaacaaagtatacttccccaactctcttaatttgcctgctttaaccaccttggctgtaaggttcttccactttcgcg |
30054862 |
T |
|
| Q |
101 |
ctggcgatgatggttgaatactttggtcattgaaagttttatacttgtggaggatgcagaaactctttgtatatcaagtgacacacttgtcaatttgact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30054861 |
ctggcgatgatggttgaatactttggtcattgaaagttttagacttgtggaggatgtagaaactctttgtatatcaagtgacacacttgtcaatttgact |
30054762 |
T |
|
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
30054761 |
at |
30054760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 45906437 - 45906385
Alignment:
| Q |
152 |
ggatgcagaaactctttgtatatcaagtgacacacttgtcaatttgactatgt |
204 |
Q |
| |
|
||||||| |||| ||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
45906437 |
ggatgcaaaaaccctttgcatatcaagtggaacacttgtcaatttaactatgt |
45906385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University