View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_low_5 (Length: 368)
Name: NF10839_low_5
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 104 - 309
Target Start/End: Complemental strand, 381883 - 381678
Alignment:
| Q |
104 |
gctcttacttgtctttctcagtttacattagaggtaacctttttgtgctcttcaaatggatactaattgctgaaagaaaagagcatcattactggtataa |
203 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
381883 |
gctctaacttgtctttctcaatttacattagaggtaacctttctatgctcttcaaatggatactaattgctgaaagaaaagagcatcattagtggtataa |
381784 |
T |
|
| Q |
204 |
agggtcaggggagatggaatatttgcactactgcatatgtttctcattgttgcttttcaccttgtaaataggaagattgaaagaaggaacataatcttgc |
303 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
381783 |
agggtcaatggagatggaatctttgcacaactgcataagtttatcattgttgcttttcaccttgtaaataggaagattgaaagaaggaacataatcttgc |
381684 |
T |
|
| Q |
304 |
tctaaa |
309 |
Q |
| |
|
|||||| |
|
|
| T |
381683 |
tctaaa |
381678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 381970 - 381926
Alignment:
| Q |
18 |
gtttttggggtccccattttggttcattcattcagaaggatgctg |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
381970 |
gtttttggggtccccattttggttcattcattcagaaggatgctg |
381926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University