View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10839_low_7 (Length: 338)
Name: NF10839_low_7
Description: NF10839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10839_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 12 - 147
Target Start/End: Complemental strand, 55392396 - 55392261
Alignment:
| Q |
12 |
aaaggaggagagagagtgagtgacttgattaagaggattgtcaggagatttcttccaaagcttccaaatcatgtccttgtattgtgtgtatgtaagccct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55392396 |
aaaggaggagagagagtgagtgacttgattaagaggattgtcaggagatttcttccaaagcttccaaatcatgtccttgtattgtgtgtatgtaagccct |
55392297 |
T |
|
| Q |
112 |
ggtttctcttgcttcaacttaggtagttcagcttct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55392296 |
ggtttctcttgcttcaacttaggtagttcagcttct |
55392261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 215 - 323
Target Start/End: Complemental strand, 55392192 - 55392084
Alignment:
| Q |
215 |
cagataaaacgatacataccttgaaggaagccttgaggcgcctctctggatgcctgtcgggaggtaagttgttatcgatactcatctgagcgatggcttc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55392192 |
cagataaaacgatacataccttgaaggaagccttgaggcgcctctctggatgcctgtcggggggtaagttgttatcgatactcatctgagcgatggcttc |
55392093 |
T |
|
| Q |
315 |
gtcaagagt |
323 |
Q |
| |
|
||||||||| |
|
|
| T |
55392092 |
gtcaagagt |
55392084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University