View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10840_low_7 (Length: 250)
Name: NF10840_low_7
Description: NF10840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10840_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 102 - 245
Target Start/End: Complemental strand, 15182750 - 15182606
Alignment:
| Q |
102 |
gatcaattttaggcatttacgaataactctcacattcatcaaattaaatcacactatcatatgtcatataagcacaactcagttgataactgcaaagata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
15182750 |
gatcaattttaggcatttacgaataactctcacattcatcaaattaaatcacactatcatatgtcatgtaagcacaactcagttgatagctgcaaagata |
15182651 |
T |
|
| Q |
202 |
atattattat-ggactgacgtttgaaccctagactctctgcttct |
245 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
15182650 |
atattattatgggattgatgtttgaaccctagactctctacttct |
15182606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 15182851 - 15182813
Alignment:
| Q |
1 |
ttttctaaggttataaaagaaagtgtatggtaaatgtgt |
39 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15182851 |
ttttctgaggttataaaagaaagtgtatggtaaatgtgt |
15182813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Original strand, 39901108 - 39901153
Alignment:
| Q |
159 |
catatgtcatataagcacaactcagttgataactgcaaagataata |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||| ||||||| |
|
|
| T |
39901108 |
catatgtcatgtaagcacaactcagttggtagctgcaacgataata |
39901153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University