View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_17 (Length: 297)
Name: NF10841_high_17
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 32832351 - 32832087
Alignment:
| Q |
18 |
ttatatacataagaaaagatcttaaaatatcatcagttcaagttgaaattctagtaggatgtttgaatgtttgttcattgattggatcattggtatcagg |
117 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32832351 |
ttatatacataagaaaagatttgaaaatatcatcagttcaagttgaaattctagtaggatgtttgaatgtttgttcattgattggatcattggtatcagg |
32832252 |
T |
 |
| Q |
118 |
gaaaatttctgatatgattggaagaagatatacaataatgattgcagcattaacatttttaataggtgcattattaatgggattagcaccatcatttaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32832251 |
gaaaatttctgatatgattggaagaagatatacaataatgattgcagcattaacatttttaataggtgcattattaatgggattagcaccatcatttaca |
32832152 |
T |
 |
| Q |
218 |
ttcttaatgtttggtcgtgtaatagctggcattggtgttggtttttctcttatgatttcacctgt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32832151 |
ttcttaatgtttggtcgtgtaatagctggcattggtgttggtttttctcttatgatttcacctgt |
32832087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University