View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_23 (Length: 250)
Name: NF10841_high_23
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 4337348 - 4337587
Alignment:
| Q |
10 |
agatgaaagatgtgaaagacttgccaggtaaattttaatttgagctgannnnnnnctcttgaaaactccatatccggcctaaggaccaactaatcc-ggg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4337348 |
agatgaaagatgtgaaagacttgccaggtaaattttaatttgagctgatttttttctcttgaaaactccatatccggcctaaggaccaactaatccgggg |
4337447 |
T |
 |
| Q |
109 |
ggataaatcccactaaccactagc-gggggccccaattgctacaagaacaaagctttgtatctccattgggcccaacacaagaatttttggtacttgggg |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4337448 |
ggataaatcccactaaccactagcgggggggcccaattgctaccagaacaaagctttgtat---ggagcggcccaacacaagaatttttggtacttgggg |
4337544 |
T |
 |
| Q |
208 |
aattcaaattcgatacctagagaagagcacgctcctagatccc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337545 |
aattcaaattcgatacctagagaagagcacgctcctagatccc |
4337587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University