View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_29 (Length: 239)
Name: NF10841_high_29
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 46874650 - 46874874
Alignment:
| Q |
1 |
tattgggattcattcggaaatgagatgtgtgctcaacatgggtgctgcatttttccctgtatgaaatacaggtactggacttgtggataactggagaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874650 |
tattgggattcattcggaaatgagatgtgtgctcaacatgggtgctgcatttttccctgtatgaaatacaggtactggacttgtggataactggagaacc |
46874749 |
T |
|
| Q |
101 |
aaactgtattttattcgttgtaagatttatgaaagcttctcaaatgagttcaagactcataaattaatatgtgaagtaagaaattttacattactagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874750 |
aaactgtattttattcgttgtaagatttatgaaagcttctcaaatgagttcaagactcataaattaatatgtgaagtaagaaattttacattactagagc |
46874849 |
T |
|
| Q |
201 |
ttctcaatttattagtttctccttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46874850 |
ttctcaatttattagtttctccttg |
46874874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 94 - 166
Target Start/End: Original strand, 46892525 - 46892597
Alignment:
| Q |
94 |
gagaaccaaactgtattttattcgttgtaagatttatgaaagcttctcaaatgagttcaagactcataaatta |
166 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
46892525 |
gagaaccaaactgtattttattcatagtaagatttatgaaagcttctcaattgagttctagactcataaatta |
46892597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 46892471 - 46892515
Alignment:
| Q |
20 |
atgagatgtgtgctcaacatgggtgctgcatttttccctgtatga |
64 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
46892471 |
atgagatgtgtactcaacatgggtgcggcatttttccctatatga |
46892515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University