View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_43 (Length: 205)
Name: NF10841_high_43
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 37418310 - 37418145
Alignment:
| Q |
16 |
agagaatacgacagataattgagtctggaagggagctaaccctgtcgcacttttctgttggaatccatgatcgttgcttcttcgacttggacatcgcagt |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37418310 |
agagaatatgacagataattgagtctggaagggagctaaccctgtcgcacttttctgttggaatccatgatcgttgcttcttcgacttggacatcgcagt |
37418211 |
T |
 |
| Q |
116 |
tgattgtaaaaccaggatctgatgatatgattgcctttgaactcgaactctctctgggagacagacagagtttg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37418210 |
tgattgtaaaaccaggatctgatgatatgattgcctttgaa--------ctctctgggagacagacagagtttg |
37418145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 16 - 133
Target Start/End: Original strand, 53341095 - 53341218
Alignment:
| Q |
16 |
agagaatacgacagataattgagtctggaagggagctaaccctgtcg------cacttttctgttggaatccatgatcgttgcttcttcgacttggacat |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||| ||||||| |||||||| ||||| ||||| |
|
|
| T |
53341095 |
agagaatgtgacagataattgagtctggaagggagctaaccctgtcgtactcacactcttctattggtatcgatgatcgctgcttcttggactttgacat |
53341194 |
T |
 |
| Q |
110 |
cgcagttgattgtaaaaccaggat |
133 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
53341195 |
cgcagttgattgcaaaaccaggat |
53341218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 53059036 - 53058933
Alignment:
| Q |
16 |
agagaatacgacagataattgagtctggaagggagctaaccctgtcgcacttttctgttggaatc---catgatcgttgcttcttcgacttggacatcgc |
112 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||| |||| ||| |||||||| ||||||| |||||||||||||||||||| || |
|
|
| T |
53059036 |
agagaatgtgacagataattgagtccggaagggagctaaccctgtcacactcttcaattggaatcgatgatgatcgctgcttcttcgacttggacatggc |
53058937 |
T |
 |
| Q |
113 |
agtt |
116 |
Q |
| |
|
|||| |
|
|
| T |
53058936 |
agtt |
53058933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 28 - 109
Target Start/End: Complemental strand, 53067957 - 53067876
Alignment:
| Q |
28 |
agataattgagtctggaagggagctaaccctgtcgcacttttctgttggaatccatgatcgttgcttcttcgacttggacat |
109 |
Q |
| |
|
||||||| ||||| ||||||||||||||| ||| || || |||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
53067957 |
agataatcgagtccggaagggagctaaccttgttgcgctcttctattggaatcgatgatcgccgcttcttcgacttggacat |
53067876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 116
Target Start/End: Complemental strand, 53062200 - 53062114
Alignment:
| Q |
34 |
ttgagtctggaagggag-ctaaccctgtcgcacttttctgttggaatccatgat---cgttgcttcttcgacttggacatcgcagtt |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| ||| |||||||| ||||| || |||||||||||||||||||| |||||| |
|
|
| T |
53062200 |
ttgagtctggaagggagactaaccctgtcacactcttcaattggaatcgatgatgatcgctgcttcttcgacttggacatggcagtt |
53062114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 109
Target Start/End: Complemental strand, 31013738 - 31013642
Alignment:
| Q |
16 |
agagaatacgacagataattgagtctggaagggagctaaccctgtcgcacttttctgttggaatccatgatcgttg---cttcttcgacttggacat |
109 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| |||||||||||| |||| |||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
31013738 |
agagaatgtgacagataattgagtccggaagggagctatccctgtcgcactcttctattggaatcgatgatcgctgattcttcttcgacttggacat |
31013642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 6687208 - 6687145
Alignment:
| Q |
16 |
agagaatacgacagataattgagtctggaagggagctaaccctgtcgcacttttctgttggaat |
79 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
6687208 |
agagaatatgacaaataattgagtatggaagggagctaaccctgtcgtactattcttttggaat |
6687145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University