View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_7 (Length: 371)
Name: NF10841_high_7
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 3 - 362
Target Start/End: Original strand, 15381951 - 15382312
Alignment:
| Q |
3 |
gggtagcaactactacctatgcagctgaacatgcctttattacatttcaagattatattaaaatttgcatatttgaaacagaagagtataannnnnnnnn |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15381951 |
gggtagcaactactacctatgcagctgaacatgcctttattacatttcaagattatattaaaatttgcatatttgaagcagaagagtataattttttttt |
15382050 |
T |
|
| Q |
103 |
naaaaagcaacagatcttaaaaaaggtactttagtacagaatttattctctacaaaagcttaattaaaggttagacttatagagagaacttgtcattttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382051 |
-aaaaagcaacagatcttaaaaaaggtactttggtacagaatttattctctacaaaagcttaattaaaggttagacttatagagagaacttgtcattttg |
15382149 |
T |
|
| Q |
203 |
cctcaatccccgacacaaggtatattatttttgcat---acaacacttgcaaagttacacagtcacagcaccatggctttattcccatgtcttcgcnnnn |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382150 |
cctcaatccccgacacaaggtatattatttttgcatacaacaacacttgcaaagttacacagtcacagcaccatggctttattcccatgtcttcgcaaaa |
15382249 |
T |
|
| Q |
300 |
nnngtgaccatctatgcatgttaggcatttgtcttgaaatcttatcatcatcacttcctttgc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382250 |
aaagtgaccatctatgcatgttaggcatttgtcttgaaatcttatcatcatcacttcctttgc |
15382312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University