View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_high_8 (Length: 370)
Name: NF10841_high_8
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 6 - 206
Target Start/End: Complemental strand, 42409295 - 42409095
Alignment:
| Q |
6 |
caaaggtcaagcaccaaaataattaaattcaattaattaagaaaacagattctatacgataataatcaaaatttgttgcataattgagaaggaaaatgaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409295 |
caaaggtcaagcaccaaaataattaaattcaattaattaagaaaacagattctatacgataataatcaaaatttgttgcataattgagaaggaaaatgaa |
42409196 |
T |
|
| Q |
106 |
gcacctgtcatcaaagcttcttcgagagtgcggctttcaaatcttttcggaaacaagtactttgcagtctcggtagccacatcagcaacaactgcatcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409195 |
gcacctgtcatcaaagcttcttcgagagtgcggctttcaaatcttttcggaaacaagtactttgcagtctcggtagccacatcagcaacaactgcatcat |
42409096 |
T |
|
| Q |
206 |
g |
206 |
Q |
| |
|
| |
|
|
| T |
42409095 |
g |
42409095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 272 - 357
Target Start/End: Complemental strand, 42409029 - 42408944
Alignment:
| Q |
272 |
catttacgtcgctgggatagagaggcggattgagaagcgagagcgaaaatgagtgagattcgagcttcaaatgctgatatggttct |
357 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409029 |
catttacgtcgctgggatagagagaaggattgagaagcgagagcgaaaatgagtgagattcgagcttcaaatgctgatatggttct |
42408944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University