View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_10 (Length: 434)
Name: NF10841_low_10
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 15 - 425
Target Start/End: Complemental strand, 44378103 - 44377693
Alignment:
| Q |
15 |
agatctctgcatcagaactcggttccattatgggaagcttaggtcaacaaacatcagaacaagaactcaacaacatgatccgtgaagtcgacggagatgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44378103 |
agatctctgcatcagaactcggttccattatgggaagcttaggtcaacaaacatcagaacaagaactcaacaacatgatccgtgaagtcgacggagacgg |
44378004 |
T |
 |
| Q |
115 |
cgacggttgcattagtttacaagaattcatcgaactcaacaccaaaggcgttgattccgacgagatcttggagaatttgaaggatgcttttgctgttttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378003 |
cgacggttgcattagtttacaagaattcatcgaactcaacaccaaaggcgttgattccgacgagatcttggagaatttgaaggatgcttttgctgttttt |
44377904 |
T |
 |
| Q |
215 |
gatatggatgggaatggttcgattacggcggaagagcttaatacggttatgagaagccttggggaagaatgctcgttggcggagtgccggaaaatgatcg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377903 |
gatatggatgggaatggttcgattacggcggaagagcttaatacggttatgagaagccttggggaagaatgctcgttggcggagtgccggaaaatgatcg |
44377804 |
T |
 |
| Q |
315 |
gaggtgttgatagcgacggtgatggaacaattgattttgaagagtttaggatgatgatgatgatgggttctcgtcatgatacgacggatagagtcaaacc |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377803 |
gaggtgttgatagcgacggtgatggaacaattgattttgaagagtttaggatgatgatgatgatgggttctcgtcatgatacgacggatagagtcaaacc |
44377704 |
T |
 |
| Q |
415 |
tgaacctatgc |
425 |
Q |
| |
|
||||||||||| |
|
|
| T |
44377703 |
tgaacctatgc |
44377693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 376
Target Start/End: Complemental strand, 11350233 - 11350177
Alignment:
| Q |
320 |
gttgatagcgacggtgatggaacaattgattttgaagagtttaggatgatgatgatg |
376 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||||||||| || |||||||||| |
|
|
| T |
11350233 |
gttgatagcgatggtgatggaatgatcgattttgaagagtttaagaagatgatgatg |
11350177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 320 - 387
Target Start/End: Complemental strand, 37655427 - 37655360
Alignment:
| Q |
320 |
gttgatagcgacggtgatggaacaattgattttgaagagtttaggatgatgatgatgatgggttctcg |
387 |
Q |
| |
|
|||||||| || |||||||| | ||||||||||| || ||||| || |||||||||||||||||||| |
|
|
| T |
37655427 |
gttgatagtgatggtgatggtaggattgattttgaggattttagaatcatgatgatgatgggttctcg |
37655360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University