View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_100 (Length: 239)
Name: NF10841_low_100
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 47583454 - 47583679
Alignment:
| Q |
1 |
acaactaattagaaccaattctattactttttacgatatctt---cagatcatagttcaattgattaaatcatgatttttagtttcttattcagatgaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47583454 |
acaactaattagaaccaattctattactttttgtgatatcttcttcagatcatagttcaattgattaaatcatgatttttagtttcttattccgatgaat |
47583553 |
T |
|
| Q |
98 |
tgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcagggacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggaggg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583554 |
tgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcaggtacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggaggg |
47583653 |
T |
|
| Q |
198 |
ttggatttggatgtgggagtgtttaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47583654 |
ttggatttggatgtgggagtgtttaa |
47583679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University