View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_105 (Length: 234)
Name: NF10841_low_105
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 41367222 - 41367088
Alignment:
| Q |
1 |
gaacacaataattattgcaaaaattaccaagataggattggggcaaaaatttacccctttcatatccaccaactcttctaccttaaccatgtccctcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367222 |
gaacacaataattattgcaaaaattaccaagataggattggtgcaaaaatttacccctttcatatccaccaactcttctaccttaaccatgtccctcagg |
41367123 |
T |
|
| Q |
101 |
attaatatcctcatcaaatttctcttattccttaa |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
41367122 |
attaatatcctcatcaaattactcttattccttaa |
41367088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 172 - 216
Target Start/End: Complemental strand, 41367090 - 41367046
Alignment:
| Q |
172 |
taagaccacaattaaagcaaaacatagtgagattcacgtacctaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367090 |
taagaccacaattaaagcaaaacatagtgagattcacgtacctaa |
41367046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University