View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_108 (Length: 228)
Name: NF10841_low_108
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_108 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 43222243 - 43222470
Alignment:
| Q |
1 |
agtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgccattgaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222243 |
agtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgccattgaaata |
43222342 |
T |
|
| Q |
101 |
gactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaaagtgatcttgctccaatggacagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43222343 |
gactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaaaatgatcttgctccaatggacagt |
43222442 |
T |
|
| Q |
201 |
tcactgagtaaactgtcatcaactgatc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43222443 |
tcactgagtaaactgtcatcaactgatc |
43222470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 176
Target Start/End: Original strand, 43232677 - 43232831
Alignment:
| Q |
22 |
tcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgccattgaaatagactagagacttcctgagaga |
121 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||||||||||||||||| |||||| |||||| || |||||| ||||||||| ||||||||||| |
|
|
| T |
43232677 |
tcacctgatcgtaatttagaacttcctctgcttgatgatcaacagctgcaattgtgccaacaggtgcacctctgaaatggactagagatttcctgagaga |
43232776 |
T |
|
| Q |
122 |
ttcccaggcatcagcaagcattggctgaggctcgaacgagttctgagcagatgaa |
176 |
Q |
| |
|
||||||||||||||||| |||||| || ||||| |||||||| ||||||||||| |
|
|
| T |
43232777 |
ttcccaggcatcagcaaccattggatgcggctcaaacgagttgcgagcagatgaa |
43232831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University