View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10841_low_113 (Length: 225)

Name: NF10841_low_113
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10841_low_113
NF10841_low_113
[»] chr1 (1 HSPs)
chr1 (18-215)||(47651100-47651297)
[»] scaffold0031 (1 HSPs)
scaffold0031 (19-70)||(93015-93066)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 47651297 - 47651100
Alignment:
18 actaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47651297 actaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggt 47651198  T
118 ctttagctctctagcagtttggtgcaggtttttactggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtctgtgcttc 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
47651197 ctttagctctctagcagtttggtgcaggtttttactggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtcggtgcttc 47651100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 93066 - 93015
Alignment:
19 ctaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgtt 70  Q
    ||||||||| |||||||  | |||||||||||||||||||| ||||||||||    
93066 ctaaaagggaaagaattgggaattaatgtaacaaatttgtctgtttaatgtt 93015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University