View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_115 (Length: 222)
Name: NF10841_low_115
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_115 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 20 - 134
Target Start/End: Original strand, 47155737 - 47155851
Alignment:
| Q |
20 |
gcttgagccacattgtgaacactactgtcctccattgaagcaaacttcactgcaacgataatcacttttcagagataatcgcttttcgtcaacagagaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47155737 |
gcttgagccacattgtgaacactactgtcctccattgaagcaaacttcactgcaacgataatcacttttcagagataatcgcttttcgtcaacagagaga |
47155836 |
T |
 |
| Q |
120 |
aagagagataatcgc |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47155837 |
aagagagataatcgc |
47155851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University