View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_117 (Length: 221)
Name: NF10841_low_117
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_117 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 23365711 - 23365896
Alignment:
| Q |
18 |
agagagatgaaggtgagggaaaagaatagagaaaatgagtcatctaacttccaaccaaaaa--ttaaggaagaatttatttgacactcgctatgaaagct |
115 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |||||||| |||||||||| ||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
23365711 |
agagagatggaggtgaaagaaaagaatagagaaaatgagttatctaactaccaaccaaaatatttaaggaagaattgatttgacgctctatatgaaagct |
23365810 |
T |
 |
| Q |
116 |
aggatttgaaacttctcatggaattgattttgaaagaatgaatcgggttttataaaagagaaccaaaatcccgcaaaatgaagaaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23365811 |
aggatttgaaacttctcatggaattgattctaaaagaatgaatc-ggttttataaaagagaaccaaaatcctacaaaatgaagaaac |
23365896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University