View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_120 (Length: 219)
Name: NF10841_low_120
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_120 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 5433121 - 5432935
Alignment:
| Q |
19 |
tatgatgcctcggttcaagcagcaatattgagtgttgaaggagacaagaaaattcaagacttgttgttgttagatgttatacctcacagtcttggtgttg |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5433121 |
tatgatgcctcggttcaagcagcgatattgagtgttgaaggagacaagaaaattcaagacttgttgttgttagatgttatacctcacagtcttggtgttg |
5433022 |
T |
|
| Q |
119 |
aaactgatggtggtgtcatgtttgttttgattcgaaagaacacattgatcccga-caaaaaataaagtgttttcgctacagtctctg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
5433021 |
aaactgatggtggtgtcatgtttgttttgattcgaaagaacacattgatcccgaccaaaaaaaaaagtgttttcgctacagtctctg |
5432935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 179
Target Start/End: Original strand, 5446272 - 5446420
Alignment:
| Q |
31 |
gttcaagcagcaatattgagtgttgaaggagacaagaaaattcaagacttgttgttgttagatgttatacctcacagtcttggtgttgaaactgatggtg |
130 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |||||||||| |||| |||||||| ||| |||||||||||||||||| | |||| |
|
|
| T |
5446272 |
gttcaagcagcaatattgaatactgaaggagacaagaaaatcgaagacttgttactgttggatgttatgccttttagtcttggtgttgaaactaaaggtg |
5446371 |
T |
|
| Q |
131 |
gtgtcatgtttgttttgattcgaaagaacacattgatcccgacaaaaaa |
179 |
Q |
| |
|
||||||||| ||||||||||| |||||| || ||||||| || ||||| |
|
|
| T |
5446372 |
gtgtcatgtctgttttgattccaaagaatactatgatccctacgaaaaa |
5446420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University