View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_124 (Length: 217)
Name: NF10841_low_124
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 53676151 - 53675957
Alignment:
| Q |
20 |
cattgatgataaagtgatgactgtaactannnnnnncaagaattgcaaatagtccaacaagctttcctaccaactggaagtaaaa---------ctaaaa |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53676151 |
cattgatgataaagtgatgaatgtaactatttttttcaagaattgcaaatagtccaacaagctttcctaccaactggaagtaaaaaaaaaaaaactaaaa |
53676052 |
T |
 |
| Q |
111 |
ataataaaggcacaaaattttgtaaaaaggaggttcatttttggcttatataacaagacaagataaaatgatatacatgcccaccacctttgctt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676051 |
ataataaaggcacaaaattttgtaaaaaggaggttcatttttggcttatataacaagacaagataaaatgatatacatgcccaccacctttgctt |
53675957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University