View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_125 (Length: 217)
Name: NF10841_low_125
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_125 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 9 - 202
Target Start/End: Original strand, 40455846 - 40456039
Alignment:
| Q |
9 |
agcagagaccaaccttctcaatagacaatcgtctgcgataagtcttctggttcaaggaaaacctttatacaactcctaaacacatcaactgcactcaaaa |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40455846 |
agcaaagaccaaccttctcaatagacaatcgtctgcgataagtcttctggttcaaggaaaacctttatacaactcctaaacacatcaactgtactcaaaa |
40455945 |
T |
|
| Q |
109 |
tcgatcattgatcaatactgcagaaattcagacacaacacccaacaaatatgcagtcaaagattttgttttgaatttggagtttttgttccatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40455946 |
tcgatcattgatcaatactgcagaaattcagacacaacacctaacaaatatgcagtaaaagattttgttttgaatttggagtttttgttccatc |
40456039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 40286769 - 40286725
Alignment:
| Q |
154 |
aaatatgcagtcaaagattttgttttgaatttggagtttttgttc |
198 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40286769 |
aaatatgcagtcacagattttgctttgaatttggagtttttgttc |
40286725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University