View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_131 (Length: 213)
Name: NF10841_low_131
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_131 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 42 - 195
Target Start/End: Original strand, 41551159 - 41551312
Alignment:
| Q |
42 |
gagtttctttaaatgcattttagtttggtgaatttatggcctaaatattgtttagatcttgaaattaatgtttcgttttgacttgaaagagtcttaatag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551159 |
gagtttctttaaatgcattttagtttggtgaatttatggcctaaatattgtttagatcttgaaattaatgtttcgttttgacttgaaagagtcttaatag |
41551258 |
T |
|
| Q |
142 |
taatttaattatctgaaggtatgaaagattcgaaggaatttgcactggaactct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551259 |
taatttaattatctgaaggtatgaaagattcgaaggaatttgcactggaactct |
41551312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University