View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_135 (Length: 206)
Name: NF10841_low_135
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_135 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 46875231 - 46875409
Alignment:
| Q |
19 |
ttttggtcctctcttttaacccttccttgattctcacttgacagttgaaccttgttgaaaaatcaaaacaaagctaacatgcatgcaccttgtttggagc |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46875231 |
ttttggtcctctcttt-aacccttccttgattctcacttgacagttgaaccttgttgaaaaatcaaaacaaagctaacatgcatgcaccttgtttggagc |
46875329 |
T |
|
| Q |
119 |
aacatcttcaagtgtttccttctcatttctatatattcctttttccaaaacagactctcaccctaaacttctctgcttct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
46875330 |
aacatcttcaagtgtttccttctcatttctatatattcctttttccaaaacagactctcaccctacacttctcttcttct |
46875409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University