View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_16 (Length: 403)
Name: NF10841_low_16
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 264 - 393
Target Start/End: Original strand, 19305848 - 19305977
Alignment:
| Q |
264 |
ttgtggggattttaatcttaggttcttctgttgatgggattgttttatttgttttggtaggtgatgtactattgtaggtgcgaggtatgtattactcctt |
363 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19305848 |
ttgtggggattttaatcttaggtccttctgttagtgggattgttttatttgttttggtaggtgatgtactattgtaggtgcggggtatgtattactcctt |
19305947 |
T |
|
| Q |
364 |
tgtaattttgagtccattccactttctctg |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19305948 |
tgtaattttgagtccattccactttctctg |
19305977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 87 - 163
Target Start/End: Original strand, 13246875 - 13246951
Alignment:
| Q |
87 |
tcgtgtttacatattcttcccaatctcaccactgtaagtcttctttactctcaatccataactgtaatctatcaatt |
163 |
Q |
| |
|
||||| |||| | |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13246875 |
tcgtgcttacgttttcttcccaatctcacaactgtaagtcttctttactctcaatccataattgtaatctctcaatt |
13246951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 339 - 393
Target Start/End: Complemental strand, 25812276 - 25812222
Alignment:
| Q |
339 |
aggtgcgaggtatgtattactcctttgtaattttgagtccattccactttctctg |
393 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25812276 |
aggtgcggggtatgtattactcctttgtaattttgagtccattccactttctctg |
25812222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 101 - 148
Target Start/End: Complemental strand, 25814805 - 25814758
Alignment:
| Q |
101 |
tcttcccaatctcaccactgtaagtcttctttactctcaatccataac |
148 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25814805 |
tcttcccaatctcaccaccgtaagtcttctttactctcaatccataac |
25814758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University