View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10841_low_16 (Length: 403)

Name: NF10841_low_16
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10841_low_16
NF10841_low_16
[»] chr5 (1 HSPs)
chr5 (264-393)||(19305848-19305977)
[»] chr1 (1 HSPs)
chr1 (87-163)||(13246875-13246951)
[»] chr2 (2 HSPs)
chr2 (339-393)||(25812222-25812276)
chr2 (101-148)||(25814758-25814805)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 264 - 393
Target Start/End: Original strand, 19305848 - 19305977
Alignment:
264 ttgtggggattttaatcttaggttcttctgttgatgggattgttttatttgttttggtaggtgatgtactattgtaggtgcgaggtatgtattactcctt 363  Q
    ||||||||||||||||||||||| ||||||||  |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
19305848 ttgtggggattttaatcttaggtccttctgttagtgggattgttttatttgttttggtaggtgatgtactattgtaggtgcggggtatgtattactcctt 19305947  T
364 tgtaattttgagtccattccactttctctg 393  Q
    ||||||||||||||||||||||||||||||    
19305948 tgtaattttgagtccattccactttctctg 19305977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 87 - 163
Target Start/End: Original strand, 13246875 - 13246951
Alignment:
87 tcgtgtttacatattcttcccaatctcaccactgtaagtcttctttactctcaatccataactgtaatctatcaatt 163  Q
    ||||| |||| | |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||    
13246875 tcgtgcttacgttttcttcccaatctcacaactgtaagtcttctttactctcaatccataattgtaatctctcaatt 13246951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 339 - 393
Target Start/End: Complemental strand, 25812276 - 25812222
Alignment:
339 aggtgcgaggtatgtattactcctttgtaattttgagtccattccactttctctg 393  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
25812276 aggtgcggggtatgtattactcctttgtaattttgagtccattccactttctctg 25812222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 101 - 148
Target Start/End: Complemental strand, 25814805 - 25814758
Alignment:
101 tcttcccaatctcaccactgtaagtcttctttactctcaatccataac 148  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
25814805 tcttcccaatctcaccaccgtaagtcttctttactctcaatccataac 25814758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University