View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_23 (Length: 379)
Name: NF10841_low_23
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 369
Target Start/End: Complemental strand, 7631708 - 7631354
Alignment:
| Q |
17 |
tcaagatctactgaatcacgcaacacaagctgctggtgtgcttcctgcccacgaggaaagaagagcgacaaggcttagtttagatttgactgtttgcagc |
116 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7631708 |
tcaagatctactgaatcacgcaacatacgctgctggtgtgcttcctgcctgcgaggaaagaagagcgacaaggtttagtttagatttgactgtttgcagc |
7631609 |
T |
|
| Q |
117 |
atgggaacggattacccaaaaaatccctgggaacaatgnnnnnnntaca--tatcttggtaacgaaaacaatagagggtactcccctttgttttagtagg |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| | | ||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631608 |
atgggaacagattacccaaaaaatccctgggaacaatgaaaaaaaaaaaaatatctcgataacgaaaacaatagagggtactcccctttgttttagtagg |
7631509 |
T |
|
| Q |
215 |
cgccagtcttcatctggccgcattgcatcaatatggatcaaataatccattggatgtacattcagagatggatcaaatttcatacattatataagaactc |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631508 |
cgccaatcttcatctggccgcattgcatcaatatggatcaaataatccattgggtgtacattcagagatggatcaaatttcatacattatataagaacta |
7631409 |
T |
|
| Q |
315 |
tggtttaacggtttttatcatagaactcaaaagcaaagtaatagaataacctatg |
369 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631408 |
tgatttaacggtttttatcatagaactcaaaagcaaagtaatagaataacctatg |
7631354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 2112131 - 2112091
Alignment:
| Q |
114 |
agcatgggaacggattacccaaaaaatccctgggaacaatg |
154 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2112131 |
agcatgggagcggattacccaaaaaatccctgggaacaatg |
2112091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University