View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_34 (Length: 358)
Name: NF10841_low_34
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 327; Significance: 0; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 18 - 348
Target Start/End: Complemental strand, 1809870 - 1809540
Alignment:
| Q |
18 |
atgagaatcttttgatgtgagattaaagtggtcaaacctacaaggtatgtggaagaaagcaaagtaacaccttgattagactatggaaataacacactta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1809870 |
atgagaatcttttgatgtgagattaaagtggtcaaacctacaaggtatgtggaagaaagcaaagtaacaccttgattagactatggaaataacacactta |
1809771 |
T |
|
| Q |
118 |
acagcttcttacaaattaagaataaacttgattacaataagcagtgctgtgaacaagatcatgattgataaggccattaatctaattcatgtgctagcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1809770 |
acagcttcttacaaattaagaataaacttgattacaataagcagtgctgtgaccaagatcatgattgataaggccattaatctaattcatgtgctagcat |
1809671 |
T |
|
| Q |
218 |
ccaataaaagaatggtgctaaggttcattggcttcatgtatcttgttgaacctgacattatttgctccacaataagtctatttgccttttcagatggatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1809670 |
ccaataaaagaatggtgctaaggttcattggcttcatgtatcttgttgaacctgacattatttgctccacaataagtctatttgccttttcagatggatg |
1809571 |
T |
|
| Q |
318 |
gaatggatcccaaaatacatacaagtctctg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1809570 |
gaatggatcccaaaatacatacaagtctctg |
1809540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 347
Target Start/End: Complemental strand, 48102599 - 48102481
Alignment:
| Q |
229 |
atggtgctaaggttcattggcttcatgtatcttgttgaacctgacattatttgctccacaataagtctatttgccttttcagatggatggaatggatccc |
328 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||| ||| |||||||||||| | | ||||||||||||||||||||||||| ||||| |
|
|
| T |
48102599 |
atggtgctaaggttcattggattcatgtatcttttagaacctgacaaaattcgctccacaataattttgtttgccttttcagatggatggaatgcatccc |
48102500 |
T |
|
| Q |
329 |
aaaatacatacaagtctct |
347 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
48102499 |
aaaatgcatacaagtctct |
48102481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 332
Target Start/End: Complemental strand, 48085279 - 48085245
Alignment:
| Q |
298 |
tttgccttttcagatggatggaatggatcccaaaa |
332 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48085279 |
tttgccttttcagatggatggaatgcatcccaaaa |
48085245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 285 - 347
Target Start/End: Original strand, 7385558 - 7385620
Alignment:
| Q |
285 |
cacaataagtctatttgccttttcagatggatggaatggatcccaaaatacatacaagtctct |
347 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
7385558 |
cacaataagcttgtttgccttttcagatggatggaatgcatcccaaaatgcatttaagtctct |
7385620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 304 - 338
Target Start/End: Original strand, 35376285 - 35376319
Alignment:
| Q |
304 |
ttttcagatggatggaatggatcccaaaatacata |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
35376285 |
ttttcagatggatggaatggatcccaaaatgcata |
35376319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University