View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_59 (Length: 282)
Name: NF10841_low_59
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 37242840 - 37243083
Alignment:
| Q |
18 |
acaatgtctgtagaggaagcagagagaatacttgactgccaagggcgagtcttctgcctagacgacgagcctggggtgcaccgtgtgtggttgccgaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37242840 |
acaatgtctgtagaggaagcagagagaatacttgactgccaagggcgagtcttctgcctagacgacgagcctggggtgcaccgtgtgtggttgccgaatg |
37242939 |
T |
|
| Q |
118 |
aggagtctccgggactagccatgtcaagggcttttggtgactattctatgaaagattatggtcttatttcagtgcctgaagtaacacaaaggaatataac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37242940 |
aggagtctccgggactagccatgtcaagggcttttggtgactattctatgaaagattatggtcttatttcagtgcctgaagtaacacaaaggaatataac |
37243039 |
T |
|
| Q |
218 |
aagcaaagaccagtttgttgtgctagccagtgatggggtatagt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37243040 |
aagcaaagaccagtttgttgtgctagccagtgatggggtatagt |
37243083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 120 - 257
Target Start/End: Complemental strand, 46256861 - 46256724
Alignment:
| Q |
120 |
gagtctccgggactagccatgtcaagggcttttggtgactattctatgaaagattatggtcttatttcagtgcctgaagtaacacaaaggaatataacaa |
219 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| || |||| ||| ||||||||||||||||||||||||||||| || || || |||||||||| | |
|
|
| T |
46256861 |
gagtctcctggacttgccatgtcaagggcttttggagattattgtattaaagattatggtcttatttcagtgcctgaggtgactcagaggaatataagta |
46256762 |
T |
|
| Q |
220 |
gcaaagaccagtttgttgtgctagccagtgatggggta |
257 |
Q |
| |
|
| |||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
46256761 |
gtaaagaccagtttattgtgcttgccactgatggggta |
46256724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University