View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_66 (Length: 275)
Name: NF10841_low_66
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 115 - 254
Target Start/End: Original strand, 10470124 - 10470263
Alignment:
| Q |
115 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470124 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
10470223 |
T |
|
| Q |
215 |
ttttctggaactttatgttctttcactattggattggtct |
254 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
10470224 |
ttttcaggaactttatgttctttcactgttggattggtct |
10470263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University