View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_71 (Length: 266)
Name: NF10841_low_71
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 82766 - 82532
Alignment:
| Q |
16 |
agagagagattacaggagcgtcatgttccatgttcgagcaattgcgagtgatgtgatgggctggtatagagaatgattggcatgtattttttcaatgcac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
82766 |
agagagagattacaggagcgtcatgttccatgttcgagcaattgcgagtgatgtgatgggctggtatagagaatgatcggcatgtattttttcaatgcac |
82667 |
T |
 |
| Q |
116 |
gaatagtatagattgttcgaataatgcaggtttgtcacaaattattcaggcccgtctgcaacagtttgattcggttggagaagttttgctagatgtgtgt |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82666 |
gaacagtatagattgttcgaataatgcaggtttgtcacaaattattcaggcccgtctgcaacagtttgattcggttggagaagttttgctagatgtgtgt |
82567 |
T |
 |
| Q |
216 |
gcccgtgagcaggatgagattgttagccatgtgtt |
250 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
82566 |
ggccgtgagcaggatgagattgttagccatgtgtt |
82532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University