View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_72 (Length: 264)
Name: NF10841_low_72
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 98 - 204
Target Start/End: Original strand, 29772368 - 29772474
Alignment:
| Q |
98 |
agggatggaaaatacatatttgaaattcttaaa-tatcacatattcacatttacgttggcttccagtgctactgtttctcgttgcaactttaccaaaaga |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29772368 |
agggatggaaaatacatatttgaaa-tcttaaattatcacatattcacatttacgttggcttccagtgctgctgtttctcgttgcaactttaccaaaaga |
29772466 |
T |
|
| Q |
197 |
gatgtaac |
204 |
Q |
| |
|
|||||||| |
|
|
| T |
29772467 |
gatgtaac |
29772474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University