View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_76 (Length: 258)
Name: NF10841_low_76
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 37065257 - 37065030
Alignment:
| Q |
18 |
agcaatacacaacttgggattagtaactgcaatgagaaggatcgttctgcattgctgctcttcaaacttggtgtggagaatcattcctccaacaagcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37065257 |
agcaatacacaacttgggattagtaactgcaatgagaaggatcgttctgcattgctgctcttcaaacttggtgtggagaatcattcctccaacaagcttt |
37065158 |
T |
 |
| Q |
118 |
cctcttggtccattaatgnnnnnnnttgttgttcatggaaaggagttcaatgtgacaacatcacaggtagagttacaacacttgatctacaccaacaata |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37065157 |
cctcttggtccattaatgaaaaaaattgttgttcatggaaaggagttcaatgtgacaacatcacaggtagagttacaacacttgatctacaccaacaata |
37065058 |
T |
 |
| Q |
218 |
cttggaaggtgaaatcaacttgcagtct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37065057 |
cttggaaggtgaaatcaacttgcagtct |
37065030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 194
Target Start/End: Complemental strand, 24494045 - 24493994
Alignment:
| Q |
143 |
ttgttgttcatggaaaggagttcaatgtgacaacatcacaggtagagttaca |
194 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||| || || ||||||||| |
|
|
| T |
24494045 |
ttgttgtgcatggaaaggagtccaatgtgacaacattactggcagagttaca |
24493994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University