View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_78 (Length: 255)
Name: NF10841_low_78
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_78 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 72 - 242
Target Start/End: Original strand, 6226523 - 6226693
Alignment:
| Q |
72 |
catagtttacaatcagagacactttatgcacatctgcaccacaaagctgggggtcggtggtaatgagaacttgaggagagccagactgggnnnnnnnctc |
171 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
6226523 |
catagtttacgatcagagacgctttatgcacatctgcaccacaaagctgggggtcggtggtaatgagaacttgaggagagctagactgggaaaaaaactc |
6226622 |
T |
|
| Q |
172 |
gcgcgtaacgatatccctgatgtcctgggnnnnnnncttgaggatgacaaacactttatgatctctgcttc |
242 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6226623 |
gcgcgtaactatatccctaatgtcctgggaaaaaaacttgaggatgacaaacactttatgatctctgcttc |
6226693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 158
Target Start/End: Original strand, 6233781 - 6233867
Alignment:
| Q |
72 |
catagtttacaatcagagacactttatgcacatctgcaccacaaagctgggggtcggtggtaatgagaacttgaggagagccagact |
158 |
Q |
| |
|
|||||||||| | ||||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233781 |
catagtttacgaccagagacgctttatgcaaatctgtaccacaaacgagggggtcggtggtaatgagaacttgaggagagccagact |
6233867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 161
Target Start/End: Complemental strand, 17545593 - 17545504
Alignment:
| Q |
72 |
catagtttacaatcagagacactttatgcacatctgcaccacaaagctgggggtcggtggtaatgagaacttgaggagagccagactggg |
161 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17545593 |
catagtttacgatcagagatactttatgcacatctgtaccacaaaccaaggggtctgtggtaatgagaacatgaggagagccagactggg |
17545504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University