View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10841_low_84 (Length: 250)

Name: NF10841_low_84
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10841_low_84
NF10841_low_84
[»] chr4 (1 HSPs)
chr4 (10-250)||(4337348-4337587)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 4337348 - 4337587
Alignment:
10 agatgaaagatgtgaaagacttgccaggtaaattttaatttgagctgannnnnnnctcttgaaaactccatatccggcctaaggaccaactaatcc-ggg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||| |||    
4337348 agatgaaagatgtgaaagacttgccaggtaaattttaatttgagctgatttttttctcttgaaaactccatatccggcctaaggaccaactaatccgggg 4337447  T
109 ggataaatcccactaaccactagc-gggggccccaattgctacaagaacaaagctttgtatctccattgggcccaacacaagaatttttggtacttgggg 207  Q
    |||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||        |||||||||||||||||||||||||||||||    
4337448 ggataaatcccactaaccactagcgggggggcccaattgctaccagaacaaagctttgtat---ggagcggcccaacacaagaatttttggtacttgggg 4337544  T
208 aattcaaattcgatacctagagaagagcacgctcctagatccc 250  Q
    |||||||||||||||||||||||||||||||||||||||||||    
4337545 aattcaaattcgatacctagagaagagcacgctcctagatccc 4337587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University