View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_86 (Length: 249)
Name: NF10841_low_86
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_86 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 97 - 199
Target Start/End: Complemental strand, 49811444 - 49811342
Alignment:
| Q |
97 |
ggagtataatggatatgcagacgatgtaaaagtcattcaatgagcattcatcatcttgttctataaatatactttgtcttttaaaaacaactgacatact |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49811444 |
ggagtataatggatatgcagaagatgtaaaagtcattcaatgagcattcatcatcttgttctataaatatactttgtcttttaaaaacaactgccatact |
49811345 |
T |
|
| Q |
197 |
atg |
199 |
Q |
| |
|
||| |
|
|
| T |
49811344 |
atg |
49811342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 49811714 - 49811628
Alignment:
| Q |
19 |
attatcgagaacacatattggtttgtaaagtaaagaccgcaaattttattctcaaacgcaaaacatatttttgaatgtggagtataa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49811714 |
attatcgagaacacatattggtttgtaaagtaaagaccgcaaattttattctcaaacgcaaaacatatttttgaatgtggagtataa |
49811628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 217 - 249
Target Start/End: Complemental strand, 49811323 - 49811291
Alignment:
| Q |
217 |
gtgagggggacaacaatactaacatgtgagttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49811323 |
gtgagggggacaacaatactaacatgtgagttg |
49811291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University