View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_87 (Length: 249)
Name: NF10841_low_87
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 44843540 - 44843329
Alignment:
| Q |
19 |
taaccagaaatataattctcacatgagtatcgactattgagagttatgtgtctcgttggcaatttagttgggaataacaatatgcagctctatctttaag |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44843540 |
taaccagagatataattctcacatgagtattgactattgagagttatgtgtgtcgttggcaatttagttgggagtaacaatatgcagctctatctttaag |
44843441 |
T |
|
| Q |
119 |
aattcggtatagtcttcgagagattttagcgctttgagttcaatataaatgctttatctctaagtctaaccctataaccattaaccacactctctctaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44843440 |
aattcggtatagtcttcgagagattttagcgctttgagttcaatataaatgctttatctctaagtctaaccctataaccattaaccacactctctctaac |
44843341 |
T |
|
| Q |
219 |
cctaagccctaa |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44843340 |
cctaagccctaa |
44843329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University