View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_91 (Length: 248)
Name: NF10841_low_91
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_91 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 248
Target Start/End: Original strand, 34540805 - 34541031
Alignment:
| Q |
22 |
caggcttgacttgccagaacaaaagaacgttatcattctgcatcccttcacctatacaaaaaagaaaagtaactagcatcagaatgcagcaatggatcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34540805 |
caggcttgacttgccagaacaaaagaacgttatcattctgcatcccttcacctatacaaaaaagaaaagtaactagcatcagaatgcggcaatggatcaa |
34540904 |
T |
 |
| Q |
122 |
tctatatgtgtctagggaatgtatttatgttattcttgcattttgaacactacctatcttccattttgacatactaattgctaaatcactcaattcaact |
221 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34540905 |
tctatatgtgtctagggaatgcaattatgttattcttgtattttgaacactacctatcttccattttgacatactaattgctaaatcgctcaattcaact |
34541004 |
T |
 |
| Q |
222 |
catataactcggccattgtttggttac |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34541005 |
catataactcggccattgtttggttac |
34541031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University