View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10841_low_92 (Length: 247)
Name: NF10841_low_92
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10841_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 15996125 - 15995907
Alignment:
| Q |
14 |
agatgcagaggtagagtcagttccgaagcagccaacaacaacagattgcattgctgtaggcctgatccaggagtattaaagtgtaatgttgatgcaagtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996125 |
agatgcagaggtagagtcagttccgaagcagcaaacaacaacagattgcattgctgtaggcctgatccaggagtattaaagtgtaatgttgatgcaagtt |
15996026 |
T |
|
| Q |
114 |
ttcatcggtctataaacatgacaagtaatggctgttgtatccgcggcactaccaggacggtttaatccgaagctatctgttcatggtgagcccacgggac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15996025 |
ttcatcggtctataaacatgacaagtaatggctgctgtatccgtggcactgccaggacagtttaatccgaagctatctgttcatggtgagcccacgggac |
15995926 |
T |
|
| Q |
214 |
tatgtaatgctatgaattg |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15995925 |
tatgtaatgctatgaattg |
15995907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University