View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10842_low_10 (Length: 260)
Name: NF10842_low_10
Description: NF10842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10842_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 23 - 249
Target Start/End: Complemental strand, 43149085 - 43148856
Alignment:
| Q |
23 |
ttgagatcattgattttgaaagtatacttcaagatcatctttnnnnnnnncattgctatatgtactctacataatattattattttttaatctctcgatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43149085 |
ttgagatcattgattttgaaagtatacttcaagatcatctttaaaaaaaacattgctatatgtactctacataatattattattttttaatctctcgatc |
43148986 |
T |
|
| Q |
123 |
taggtacaaatattataagccagataaaattacaagttcttggtcccctttgctgatgtagtagatg--tctgtctttcattac-nnnnnnnntatgtct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
43148985 |
taggtacaaatattataagccagataaaattacaagttcttggtcccctttgctgatgtagtagatgtctctgtctttcattacaaaaaaaaatatgtct |
43148886 |
T |
|
| Q |
220 |
gtcttttagcttaatttttccttgtcctat |
249 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
43148885 |
gtcttttagcttaatttttccttgttctat |
43148856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University