View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10842_low_11 (Length: 250)
Name: NF10842_low_11
Description: NF10842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10842_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 51753886 - 51753659
Alignment:
| Q |
12 |
tgtaactgatggcttgaaactgttattgtaacctgcagtgagattaggaccaaagataacagatacagtaaaagggaaattgaggttgggagccagaatt |
111 |
Q |
| |
|
|||| ||||| |||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51753886 |
tgtacctgatagcttgaaactgttattttaccctgcagtgagacttggaccaaagataacagatacagtaaaagggaaattgaggttgggagccagaatt |
51753787 |
T |
|
| Q |
112 |
cttcaggttggcggagtagagaaagtatttatgcaactttttaatgcaaacgacggggagaagctgttgaaagcatctcagtgttacctatcaaccacat |
211 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| ||||||||| || || || || |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
51753786 |
cttcaggttggcggagtagaaaaagtgtttatggaactttttagtgttaaagatggagagaagctgttgaaagcatcacagtgttacttatcaacaacat |
51753687 |
T |
|
| Q |
212 |
caggtcttatagctggcctcctcttcat |
239 |
Q |
| |
|
|||||| |||||| |||||||||||||| |
|
|
| T |
51753686 |
caggtcctatagcaggcctcctcttcat |
51753659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 158 - 239
Target Start/End: Complemental strand, 51766507 - 51766426
Alignment:
| Q |
158 |
caaacgacggggagaagctgttgaaagcatctcagtgttacctatcaaccacatcaggtcttatagctggcctcctcttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51766507 |
caaacgacggggagaagctgttgaaagcatctcagtgttacctatcaaccacatcaggtcttatagctggcctcctcttcat |
51766426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 61 - 239
Target Start/End: Complemental strand, 12196353 - 12196175
Alignment:
| Q |
61 |
ccaaagataacagatacagtaaaagggaaattgaggttgggagccagaattcttcaggttggcggagtagagaaagtatttatgcaactttttaatgcaa |
160 |
Q |
| |
|
||||| ||||| |||||||| ||||| || |||| || ||||| ||||||||||| ||||| ||||| || || || || |||||||| |||| || || |
|
|
| T |
12196353 |
ccaaacataaccgatacagtgaaaggaaagctgagcttaggagctagaattcttcaagttggaggagtggaaaaggtgttcatgcaactatttagtgtaa |
12196254 |
T |
|
| Q |
161 |
acgacggggagaagctgttgaaagcatctcagtgttacctatcaaccacatcaggtcttatagctggcctcctcttcat |
239 |
Q |
| |
|
| || || |||| ||| | ||||||||||| ||||| |||||||| ||||| |||| | |||| ||||| |||||||| |
|
|
| T |
12196253 |
aagatggagagaggctactaaaagcatctcaatgttatctatcaacaacatctggtcctctagcaggcctactcttcat |
12196175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University