View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10842_low_12 (Length: 240)
Name: NF10842_low_12
Description: NF10842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10842_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 40 - 240
Target Start/End: Complemental strand, 55339902 - 55339702
Alignment:
| Q |
40 |
aacaataaaaacagatattcagcaaaccaacaatgtcatatccatttttggttttcctcatacaacaacttgtcgtagtgttacgaagtgttgattgatg |
139 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55339902 |
aacaacaaaaacagatattcagcaaaccaacaatgtcatatccatttttggttttcctcgtacaacaactagtcgtagtgttacgaagtgttgattgatg |
55339803 |
T |
|
| Q |
140 |
ctgctgcttttttctttgttctgacttctgaaatgacttataaaaattgtctaggccattaaaaatgttcccagttatgttaaaggtgatgcgacattga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55339802 |
ctgctgcttttttctttgttctgacttctgaaatgactcctaaaaattgtctaggccattaaaaatgttcacagttatgttaaaggtgatgcgacattga |
55339703 |
T |
|
| Q |
240 |
t |
240 |
Q |
| |
|
| |
|
|
| T |
55339702 |
t |
55339702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University