View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10842_low_17 (Length: 222)

Name: NF10842_low_17
Description: NF10842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10842_low_17
NF10842_low_17
[»] chr5 (1 HSPs)
chr5 (20-212)||(6329477-6329669)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 6329669 - 6329477
Alignment:
20 aaattgccaaagtaaaagaaaaatcacaatgctttcattaaaagccaaacttagtagtaacccataatcataaactaaccaattggcatctcttgccaaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6329669 aaattgccaaagtaaaagaaaaatcacaatgctttcattaaaagccaaacttagtagtaacccataatcataaactaaccaattggcatctcttgccaaa 6329570  T
120 agaggaagaggtagaagagaataataaactgaaatcacgagtataagattgtaacttcccaagagatattccatccacaagccctttgcttct 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
6329569 agaggaagaggtagaagagaataataaactgaaatcacgagtataagattgtaacttcccaagagatattccatccacaagcccattgattct 6329477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University