View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10845_high_3 (Length: 288)
Name: NF10845_high_3
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10845_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 22 - 270
Target Start/End: Complemental strand, 42445196 - 42444948
Alignment:
| Q |
22 |
caccatcctccacagctgcatctaatgccgcaagtatattactctcggcacagtcttctccaaagcacactttgtaaattgctaggtgagcatgaggagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445196 |
caccatcctccacagctgcatctaatgccgcaagtatattactctcggcacagtcttctccaaagcacactttgtaaattgctaggtgagcatgaggagc |
42445097 |
T |
 |
| Q |
122 |
catccctgctgccgtacctttagcatttcctagcacttctgcattgtcgacaaaagcaccagccgctgtacttgctgtgtgagtcccgtgtccatcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445096 |
catccctgctgccgtacctttagcatttcctagcacttctgcattttcgacaaaagcaccagccgctgtacttgctgtgtgagtcccgtgtccatcctca |
42444997 |
T |
 |
| Q |
222 |
tcaattggtgcttcagctttctctccttttactgctgcattgttgaagg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444996 |
tcaattggtgcttcagctttctctccttttactgctgcattgttgaagg |
42444948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University