View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10845_low_13 (Length: 235)

Name: NF10845_low_13
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10845_low_13
NF10845_low_13
[»] chr4 (1 HSPs)
chr4 (1-218)||(42445481-42445698)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 42445481 - 42445698
Alignment:
1 ttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagaggaaaggttgttttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445481 ttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagaggaaaggttgttttgt 42445580  T
101 gtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatgatgaactcaatggttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445581 gtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatgatgaactcaatggttt 42445680  T
201 cagtctctcagctgatgt 218  Q
    ||||||||||||||||||    
42445681 cagtctctcagctgatgt 42445698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University