View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10845_low_2 (Length: 353)
Name: NF10845_low_2
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10845_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 53048724 - 53048485
Alignment:
| Q |
17 |
cataagatacagatgctcttcttttgggtttctgaaaatgtagtaacaaaacatatcaatgcaaatgcaatcaagagtgaaagtccaaacttgctcttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53048724 |
cataagatacagatgctcttcttttgggtttctgaaaatgtagtaacaaaacatatcaatgcaaatg-----aagagtgaaagtccaaacttgctcttga |
53048630 |
T |
 |
| Q |
117 |
aaacagacatcgagacctatttcagtctatggtacatgataagtatcgatttgattgtcaaaaatctcaaatgttaggctaaattagtcttttatatgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53048629 |
aaacagacatcgagacctatttcagtctatggtaaatgataagtatcgatttgattgtcaaaaatctcaaatgttaggctaaattagtcttttatatgtc |
53048530 |
T |
 |
| Q |
217 |
cttaaaaaccatcgtaacaaagactaatttgatccacatctgtaa |
261 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53048529 |
cttaaaagccatcgcaacaaagactaatttgatccacatctgtaa |
53048485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University